Nanostructured Glass–ceramic Coatings For Orthopaedic Applications-Part 3

2.2 Bonding strength and micro-hardness

  The tensile bonding strength between coating and substrate was measured in accordance with ASTM C-633-79. The testing procedure can be found in our previous work [32]. Five samples were tested indepen- dently for each type of coatings and the results were reported as mean ±  s.d.

The micro-hardness of the coatings was tested on polished coating surfaces using a Shimadzu micro hard- ness tester  (Shimadzu Co., Japan) with a load of 300 gf and a loading time of 15s. Before testing, coatings were subjected to fine polishing. Hardness values were recorded on 15 different positions. 

The results are presented as mean ±  s.d.

 


Table 1. Primers used for RT-PCR– HOB-related markers.


gene

sequence (5' –3')

melting temperature (℃)

GAPDH

F ACCCAGAAGACTGTGGATGG

60


R CAGTGAGCTTCCCGTTCAG


Runx-2

F ATGCTTCATTCGCCTCAC

60


R ACTGCTTGCAGCCTTAAAT


OPN

F TTCCAAGTAAGTCCAACGAAAG

60


R GTGACCAGTTCATCAGATTCAT


collagen type I

F AGGGTCCCAACGAGATCGAGATCCG

60


R TACAGGAAGCAGACAGGGCCAACGTCG


BSP

F ATGGCCTGTGCTTTCTCAATG

60


R GGATAAAAGTAGGCATGCTTG


 


2.3. Ion release and acellular mineralization tests

    In order to measure the ion release behaviours of HT and SP coatings, they were immersed for 7 days in a 15 ml sodium chloride solution (pH 7.4) buffered with tris(hydroxymethyl)aminomethane and hydrochloric acid (HCl –Tris-buffered solution). After soaking, pH values of the buffered solution were measured and ion concentrations were tested by inductively coupled plasma atomic emission spectroscopy (ICP-OES, Optima 3000 DV, USA).

The ability of the coatings to induce the precipitation of Ca and phosphorus (P) compounds was evaluated by immersing coatings in cell-free culture medium. Briefly, coatings were sterilized by immersion in 70 per cent ethanol solution overnight, and then washed with phosphate-buffered saline (PBS) before soaking in culture medium. Three millilitres of culture medium was added into each well of 12-well culture plate containing coating samples. The coating samples were incubated at 37℃ in a humidified, 5 per cent CO2 atmosphere for 5 h, and then washed with ultrapure water, dried and carbon-sputtered for SEM observation. The chemical composition of the deposits formed on the coating surface after mineralization was analysed using energy-dispersive spectroscopy (EDS), which was attached to the SEM instrument.



2.4. Isolation and culture of primary human osteoblasts

    Permission to use discarded human tissue was granted by the Human Ethics Committee of the University of Sydney and informed consent was obtained. Primary human osteoblasts (HOBs) were isolated from normal human trabecular bone as previously described [34]. Briefly, bone was divided into 1 mm3 pieces, washed several times in PBS, and digested with 0.02 per cent (w/v) trypsin (Sigma –Aldrich, USA) in PBS, pH 7.4, for 90 min at 37℃. Cells were then cultured in a complete media containing a-minimal essential medium (a-MEM, Gibco Laboratories, USA), supplemented with 10 per cent (v/v) heat-inactivated foetal calf serum (FCS, Gibco Laboratories), 2 mM L-glutamine (Gibco Laboratories), 25 mM Hepes buffer (Gibco Laboratories), 2 mM sodium pyruvate, 30 mg ml-1 penicillin, 100 mg ml-1 streptomycin (Gibco Laboratories) and 0.1 mM L-ascorbic acid phosphate magnesium salt (Wako Pure Chemicals, Osaka, Japan). Cells were cultured at 37℃ in an atmosphere of 5 per cent CO2 and media were refreshed every three days. Upon confluence, cells were passaged and those at passage 3 were used in the experiments.



2.5. Cell attachment and morphological observation

    After the cells reached 80–90% confluence, they were trypsinized using TrypLE Express (Invitrogen), subsequently centrifuged and suspended in complete media to produce a cell suspension with a density of  3.4×104 cells per millilitre. Then, a 1 ml cell suspension was added into each well of a 24-well cell culture plate containing coating samples. After culturing for 2, 5 and 24 h, cells were fixed in a 4 per cent paraformaldehyde solution, post-fixed using 1 per cent osmium tetroxide in PBS for 1 h, then dehydrated in a serial of graded ethanol solution (30, 50, 70, 90, 95 and 100%), and finally dried in hexamethyldisilizane for 3 min. The dried coating samples were gold-sputtered prior to SEM observation.



2.6. Cell proliferation assay

    The CellTiter 96 Aqueous Assay (Promega, USA), a colorimetric method, was used to determine the number of viable cells. The assay is a combined solution of tetrazolium compound 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulphophenyl-2H-tetrazolium) (MTS) and an electron coupling reagent (phenazine methosulphate) with a volume ratio of 20 : 1. The former compound can be bioreduced by viable cells into a formazan, which is soluble in cell culture medium. So, the absorbance of the formazan at 490 nm is directly proportional to the number of viable cellss. Four samples of each type of coatings were tested for each time point and the uncoated Ti-6Al-4V discs were used as a control. Briefly, 1 ml of cell suspension with a cell density of 8.5 × 104 cell ml-1 was added into each well of a 24-well culture plate containing the coating samples. After 3 and 7 days, the culture medium was replaced by 700 ul of the MTS working solution which was a five times diluted solution of the CellTiter 96 Aqueous Assay in PBS. After 4 h of further incubation, 100 ml of the working solution was transferred to a 96-well cell culture plate for measuring the absorbance using a microplate reader (PathTech) at 490 nm.



2.7. Quantitative real-time polymerase chain reaction

    HOBs were seeded on the coating samples at a cell density of 2 × 104 cell cm-2 and cultured for 1 dayand 7 days. After each time point, total RNA was isolated d from HOBs cultured on coating samples and the control samples of uncoated Ti-6Al-4V discs by using Trizol (Sigma) following the manufacturer's instructions. First-strand cDNA was synthesized from 0.7 ug total RNA using the Omniscript RT Kit (Qiagen, USA) according to manufacturer's instructions. The cDNA was then analysed by real-time PCR (Rotor-Gene 6000, Corbett Life Science) for the osteoblast-related genes: Runx-2, collagen type I, osteopontin (OPN) and bone sialoprotein (BSP) and their relative gene expression levels were obtained by normalizing to glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

Primers used for the selected genes are listed in table 1.


2.8. Statistical analysis

    The data were obtained from four independent experiments and expressed as mean±s.d. For statistical analysis, SPSS 17.0 program was used. Levene's test was performed to determine the homogeneity of variance for all the data, and then Tukey HSD post hoc tests were used for the data with homogeneous variance, otherwise, Tamhane's T2 post hoc was employed.

A p-value of less than 0.05 wasconsidered significant.



******to be continued******